DNA Molecular Weight Calculator

Calculate the molecular weight of any DNA sequence, oligonucleotide, or primer in Daltons and g/mol — with nucleotide-level precision.

Try:
Molecular Weight
0.000 g/mol
Calculation Breakdown
Element Atomic Mass Atoms Total %
Total Molecular Weight
Elements in this compound
In formula
Other elements

Quick Examples

Click any compound to calculate its molecular weight instantly.

Water
H₂O
18.015 g/mol
Carbon Dioxide
CO₂
44.009 g/mol
Sodium Chloride
NaCl
58.443 g/mol
Glucose
C₆H₁₂O₆
180.156 g/mol
Ethanol
C₂H₅OH
46.069 g/mol
Sulfuric Acid
H₂SO₄
98.077 g/mol

How to Use the DNA Molecular Weight Calculator

To calculate the molecular weight of a DNA sequence, enter the nucleotide sequence or the chemical formula of your oligonucleotide into the input field and press "Calculate." The calculator determines the molecular weight based on the composition and length of the strand.

Follow these 4 steps to find the molecular weight of a DNA molecule:

  1. Enter the DNA sequence using single-letter nucleotide codes (A, T, G, C) or provide the full chemical formula of the DNA strand. For a simple chemical formula approach, enter the molecular formula of each component.
  2. Specify whether the sequence is single-stranded (ssDNA) or double-stranded (dsDNA). For dsDNA, the calculator accounts for both the sense and antisense strands.
  3. Click "Calculate" or press Enter. The tool sums the residue weights of individual deoxyribonucleotides (dAMP, dTMP, dGMP, dCMP) and adjusts for phosphodiester bond formation and terminal groups.
  4. Read the molecular weight result in Daltons (Da) or g/mol. Review the breakdown table for the contribution of each nucleotide type.

This calculator is built for molecular biology researchers, graduate students designing PCR primers, and biochemists preparing DNA samples for gel electrophoresis or mass spectrometry analysis.

How the DNA Molecular Weight Calculator Works

The DNA molecular weight calculator computes the mass of a polynucleotide chain by summing the molecular weights of each deoxyribonucleotide monophosphate residue. Each residue includes the deoxyribose sugar, phosphate group, and one of four nitrogenous bases: adenine, thymine, guanine, or cytosine.

The calculation follows this general approach:

ss
ssDNA Formula
MW(ssDNA) = Σ(residue weights) - (N-1) × 18.02 + 17.01 + 79.0, where N is the number of nucleotides. The water loss accounts for phosphodiester bond formation.
ds
dsDNA Approximation
MW(dsDNA) ≈ number of base pairs × 660 Da. This approximation assumes roughly equal base composition and works well for sequences longer than 100 bp.
nt
Nucleotide Residue Weights
dAMP: 331.2 Da | dTMP: 322.2 Da | dGMP: 347.2 Da | dCMP: 307.2 Da. These are the anhydrous residue molecular weights used in summation.
bp
Base Pair Average
Average molecular weight per base pair (dsDNA) ≈ 660 Da. Average per nucleotide (ssDNA) ≈ 330 Da. These averages assume 50% GC content.

For a 20-nucleotide ssDNA primer with the sequence ATGCGATCCAGTACGTACGA, the calculator individually sums the molecular weights of 5 dAMP, 4 dTMP, 5 dGMP, and 6 dCMP residues. It subtracts 19 water molecules (19 × 18.02 Da = 342.38 Da) for the 19 phosphodiester bonds formed between 20 nucleotides and adds terminal group masses.

Accurate DNA molecular weight values are used to convert between mass concentration (ng/µL) and molar concentration (nM or pmol/µL) for experiments including quantitative PCR (qPCR), cloning, ligation reactions, and next-generation sequencing library preparation.

Common Compound Molecular Weights

Reference table of frequently searched chemical compounds.

Chemical Formula Compound Name Molecular Weight
H₂O Water 18.015 g/mol
CO₂ Carbon Dioxide 44.009 g/mol
NaCl Sodium Chloride 58.443 g/mol
NH₃ Ammonia 17.031 g/mol
CH₄ Methane 16.043 g/mol
H₂SO₄ Sulfuric Acid 98.077 g/mol
CaCO₃ Calcium Carbonate 100.086 g/mol
C₆H₁₂O₆ Glucose 180.156 g/mol
C₂H₅OH Ethanol 46.069 g/mol
HCl Hydrochloric Acid 36.461 g/mol
NaOH Sodium Hydroxide 39.997 g/mol
Ca(OH)₂ Calcium Hydroxide 74.092 g/mol
HNO₃ Nitric Acid 63.012 g/mol
KMnO₄ Potassium Permanganate 158.032 g/mol
CuSO₄ Copper(II) Sulfate 159.607 g/mol

Explore Related Chemistry Calculators

Specialized calculation tools designed for molecular biology, biochemistry, and stoichiometry.

RNA Molecular Weight Calculator

Protein Molecular Weight Calculator

Peptide Molecular Weight Calculator

Molar Mass Calculator

DNA Molecular Weight Calculator FAQs and Common Questions

Answers to common questions about calculating DNA molecular weight, nucleotide masses, primer concentrations, and unit conversions.

How is the molecular weight of a DNA strand calculated?
The molecular weight of a single-stranded DNA (ssDNA) is calculated by summing the molecular weights of each nucleotide residue and subtracting the mass of water lost per phosphodiester bond formed. The approximate formula is: MW = (number of bases × 330 Da) for a rough estimate. For precise results, sum the individual nucleotide weights: dAMP (331.2 Da), dCMP (307.2 Da), dGMP (347.2 Da), dTMP (322.2 Da), subtract 61.96 Da per internal phosphodiester bond, and add 17.01 Da for the 3' hydroxyl and 79.0 Da for the 5' phosphate.
What is the average molecular weight of a single DNA nucleotide?
The average molecular weight of a single DNA nucleotide (as a residue within a polymer) is approximately 330 Da (Daltons). This average accounts for the four deoxyribonucleotide monophosphates (dAMP, dCMP, dGMP, dTMP) at roughly equal proportions. The exact average depends on the GC content of the specific sequence.
What is the difference between ssDNA and dsDNA molecular weight?
Single-stranded DNA (ssDNA) molecular weight reflects just one strand. Double-stranded DNA (dsDNA) molecular weight is approximately twice the ssDNA molecular weight, since the two complementary strands pair together. For dsDNA, a common approximation is MW ≈ number of base pairs × 660 Da. This accounts for both strands and the loss of water during polymerization.
Can I calculate the molecular weight of a DNA primer or oligonucleotide?
Yes. Enter the primer's nucleotide sequence (e.g., ATGCGATCCA) into the calculator. The tool sums each nucleotide's residue weight, adjusts for phosphodiester bonds and terminal groups, and returns the precise molecular weight. This value is used for resuspending lyophilized primers, calculating molar concentrations, and preparing PCR master mixes.
How does GC content affect DNA molecular weight?
Higher GC content increases DNA molecular weight slightly because guanine (G) and cytosine (C) nucleotides are heavier than adenine (A) and thymine (T) nucleotides. dGMP weighs 347.2 Da compared to dAMP at 331.2 Da. For a 20-mer oligonucleotide, shifting from 25% GC to 75% GC increases the molecular weight by approximately 300–400 Da.
What units are used to express DNA molecular weight?
DNA molecular weight is expressed in Daltons (Da) or kilodaltons (kDa) for larger molecules. One Dalton equals one unified atomic mass unit (u). For practical laboratory work, the equivalent unit grams per mole (g/mol) is used interchangeably: 1 Da = 1 g/mol. Short oligonucleotides (10–50 bases) typically fall in the 3,000–16,000 Da range.